ADN comme outil pour résoudre des crimes

FONTE ZOOM:
L'ADN peut être utilisé de plus en plus à résoudre des crimes. Cet article fournit une introduction à un général qui décrit cette structure et la fonction de l'ADN, les chromosomes et les gènes. Elle se concentre plus sur les techniques de l'ADN, comme la PCR, qui sont utilisés par les spécialistes de médecine légale pour faire un profil d'ADN, également appelé ADN empreinte digitale ,. En outre, il est donné une description de l'utilisation de la base de données d'ADN et les statistiques.

1. ADN

ADN détermine à partir du moment de notre conception de la façon dont nous prenons la forme humaine dans l'utérus avec toutes les fonctionnalités qui vont avec. Comment est-il possible que l'ADN d'une substance de tous les êtres vivants de leur donner forme différente?

1.1 La découverte de l'ADN
Le corps est constitué de très nombreuses cellules. Chaque cellule a un noyau contenant l'ADN unique qui contient toutes les propriétés héritées. ADN a été découvert en 1869 par le jeune médecin suisse Miescher. Il a expérimenté avec des cellules dérivées de pus de contexte hospitalier et un précipité blanc se trouve dans les noyaux cellulaires. Miescher appelé nucléique précipité Plus tard, il a été découvert que cette substance contenait des propriétés acides et ils ont appelé l'acide nucléique. L'ADN est l'abréviation de l'acide désoxyribonucléique.

Depuis lors, la connaissance de l'ADN est fortement augmentée. Il se est avéré être une très grosse molécule. En 1944, il a été prouvé que dans l'ADN, sous forme codée, la prédisposition génétique des organismes a été enregistré. Mais ils ne savent pas comment l'ADN se copie pour chaque division et exactement comment les messages génétiques sont stockées dans l'ADN. La solution se est révélée être dans la structure de l'ADN. A cette époque, de nombreux scientifiques ont effectué des recherches sur le comment et ce que de l'ADN, de même aussi James Watson et Francis Crick.

Les blocs de construction chimiques de l'ADN ont été connus. Mais jusque-là, personne ne pouvait reconstruire la structure de l'ADN de ces briques détachées. L'infâme duo Watson et Crick est venu avec la stratégie suivante. Ils seraient aussi longues modèles de la molécule d'ADN de construire jusqu'à ce que toutes les parties se inscrirait parfaitement dans l'autre. Dans une image à rayons X a montré clairement que l'ADN avait une structure en spirale. Ils ont construit un modèle avec deux chaînes, et les différentes composantes de l'ADN au bon endroit.

L'ADN est donc une molécule à double chaîne longue. Il existe quatre types différents de molécules, qui sont désignés par les lettres A, T, C et G. Ceux-ci sont disposés sur la double hélice que A est toujours opposé T et C toujours assis en face de G. L'une spirale est donc une image miroir de l'autre. Ceci est pratique lorsque la cellule se divise. La double spirale se compose de bits - une peu plus long que l'autre en forme d'une série de molécules dans une séquence unique donnée, par exemple ACCTGAGGCTTCGGAACTTAACCGG .. Une autre pièce a un ordre différent. Les possibilités sont infinies.

Chaque morceau d'ADN - pas plus grand qu'un millionième de millimètre - donc a son propre caractère. Donc, la pièce de ?? est appelé un gène. Ce est comme un mot de passe ou un code avec un message personnel. Un gène envoie un message différent de l'autre. Le message, l'information est de nature chimique: il ya une substance sécrétée et constituée ailleurs et qu'elle fournit une certaine réaction.
  • Un gène est la plus petite unité de l'hérédité
  • Chaque contrôles de gènes - en coopération avec d'autres gènes d'un processus spécifique, y compris la formation des globules rouges, ou une prédisposition à une maladie cardiaque, ou la couleur des cheveux
  • Tous les gènes de guider l'ensemble des fonctions et des structures de l'organisme humain.

1,2 chromosomes
Dans chaque cellule de notre corps est déjà sauvé notre information génétique dans l'ADN 46 écheveaux. Ces écheveaux appelés ?? ?? chromosomes. Chaque chromosome est composé d'un grand nombre de gènes. Les chromosomes sont situés par paires les uns aux 23 autres. Lorsque la cellule se divise -ce qui se passe tous les jours dans de nombreuses cellules - diviser les chromosomes aussi pour que chaque cellule est une copie carbone de la précédente. Alors ?? Une copie est également appelé ?? ?? clone. Les seules cellules du corps qui ne contiennent pas 46 chromosomes sont les ovules et les spermatozoïdes. Contenant seulement la moitié de l'ensemble des paires, de sorte que 23 chromosomes. Lors de la fusion ovule et le sperme sont les 23 chromosomes de chaque agrégé. La nouvelle cellule a donc des propriétés à la fois le père et la mère. En conséquence, chaque nouvel individu de la reproduction sexuelle est un peu différent des deux parents, tandis que les propriétés de la division cellulaire sont les mêmes que l'un des parents.

La génétique est la science de l'hérédité. Qui se efforce de connaître tous les gènes ce qu'ils font exactement. La recherche la plus génétique se déroule dans des organismes simples, où le nombre de gènes est beaucoup plus faible que chez les humains. Il a été récemment l'ensemble du génome, afin que tous les 30 000 gènes humains mappés, cependant, ne est pas encore connu ce ces gènes.

1,3 division cellulaire
1.3.1 La division
Lorsqu'une cellule se divise, ce qui suit se produit: dans le noyau de la part de la cellule dans les chromosomes de la longueur, et les moitiés se déplacent vers les coins opposés du noyau de la cellule. Chacune des moitiés est la construction en utilisant le partage de fichiers présente chimique un nouveau volet. Ensuite, le noyau se divise en deux. Maintenant, il ya donc deux noyaux dans la cellule au lieu d'un, et chacun des noyaux qui a exactement la même information génétique que leur cellule mère. En outre, le reste de la cellule se divise en deux, de sorte qu'il ya deux nouvelles cellules complets au lieu d'un.

La division cellulaire est constamment en cours de la croissance ou pour remplacer les cellules mortes. Les cellules sont de nature différente. Il existe des cellules du cerveau, des cellules musculaires, des cellules hépatiques, les cellules du sperme, des cellules d'os, de la composition, et ainsi de suite. Chaque nouvelle cellule contient toutes les informations météo à propos de l'ensemble de notre organisme, mais également chaque cellule ne fait des copies de lui-même, de sorte que seul un nerf est prolongée par les cellules nerveuses et de la peau uniquement avec les cellules de la peau. La division cellulaire est, comme mentionné, la plus ancienne forme de reproduction. Nous appelons la reproduction asexuée. Ceci crée essentiellement à chaque fois une copie exacte de la cellule mère. La plupart des plantes et des animaux qui nous entourent, les plantes, cependant, comme nous continuent sexuellement. Un mâle et femelle individuelle apporter leur matériel génétique ensemble afin que le nouvel individu est un mélange des deux.

1.3.2 Les chromosomes X et Y
Toutes les cellules humaines contiennent 23 paires de chromosomes différents. Ils ont tous été donné un numéro. Chaque chromosome est un brin d'ADN dans des gènes divisés. Un chromosome est constitué de gènes 500-1000. Un chromosome est plus courte que l'autre, ou plus épais, ou il a une forme légèrement différente.

Il existe deux de chaque chromosome, et qui forment une paire. De chaque paire de chromosomes sont identiques. Mais il ya une exception. Chez les hommes, il ya une paire composée de moitiés inégales. La plus petite se appelle le chromosome X. Il est le même que lorsque la femme présente une paire de. L'autre, plus grande, de sorte que le chromosome trouvé seulement chez les hommes a été appelé chromosome Y. Donc la femme est moins de 23 paires un couple portant le chromosome nom de XX. L'homme de moins de 23 paires un couple portant le chromosome nom de XY. Ce est ce chromosome qui détermine le sexe de l'enfant. Si la numération des spermatozoïdes de l'homme à savoir parties, provoqué spermatozoïdes avec uniquement le chromosome X et les spermatozoïdes avec seulement le chromosome Y. Dans l'éjaculation sont, par conséquent, les deux cellules avec un X cellules chromosomiques comme avec un chromosome Y.

À la conception d'un spermatozoïde pénètre dans l'ovule. Les 23 chromosomes de chacune de ces deux cellules se rejoignent, créant ainsi une nouvelle cellule a 46 chromosomes dans le noyau. La cellule unique fécondé contient donc toutes les informations génétiques du nouvel individu. Une chose est fixé de la conception, à savoir la production de nouvel individu. Contient le sperme qui est le premier dans l'œuf pénètre un chromosome X de la cellule fécondé est un chromosome XX. Les informations de ce chromosome se assure que la cellule se développe en direction fécondé femelle. Le premier intrus un sperme avec un chromosome Y, alors la cellule fécondé contient un chromosome XY et ce nouvel individu développe que dans la direction mâle.

Chaque nouvel individu est légèrement différente de celle des parents, parce que la nouvelle combinaison de chromosomes - réarrangement des caractéristiques génétiques - dès lors qu'il produit à nouveau de petites différences. Nous voyons que, même chez les animaux et les plantes. La reproduction sexuelle de manière a donné lieu à une large variation. Sur une période de plusieurs centaines de millions d'années, de sorte que toutes les formes imaginables de la vie se pose dans les conditions terrestres et généralement à nouveau disparu.

Une personne doit être suffisamment capable de survivre dans la région. Cela va de la conception. Si quelque chose se passe mal avec la recombinaison de gènes que la nouvelle cellule meurt bientôt. Plus tard, après la naissance, peut être ne importe quoi. L'utérus est l'environnement dans lequel l'ovule fécondé doit survivre à. Il est en fait une lutte pour l'existence entre l'utérus et la nouvelle forme de vie. L'environnement dans l'utérus peut être inadaptée, le nouvel individu est-il pas de développer, décède ou devient gravement endommagé.
Le développement de la conception à la naissance expire brièvement résumée comme suit:

1.4 La reproduction humaine
En moyenne, environ une fois par mois, lorsque fille sexuellement matures un ovule par l'un des deux ovaires. La libération d'un ovule est appelé l'ovulation. L'ovule se déplace dans la trompe de Fallope dans la direction de l'utérus. Si cet œuf ne est pas fécondé, se produit environ 14 jours après les règles.

Situé à peu de temps après l'ovulation sperme dans la trompe de Fallope peut pénétrer l'ovule l'un d'eux. Un spermatozoïde, qui ne ont besoin que de fournir le matériel génétique, est beaucoup plus petit qu'un œuf, qui contient 23 chromosomes, à l'exception des matériaux de construction et la nourriture. Les spermatozoïdes sont donc visibles uniquement au microscope. Dans une éjaculation sont des centaines de millions de spermatozoïdes. Chacune des cellules elles-mêmes survécu en essayant de percer la paroi de la cellule. Une fois qu'on a réussi, la paroi cellulaire ferme là-bas et ne viennent plus de cellules à l'intérieur.

Une fois pénétré, le sperme se déplace vers le centre de l'oeuf et les chromosomes coalescence. Environ un jour plus tard, la cellule commence à se diviser et qu'un certain nombre de fois plus, en voyageant à travers la trompe de Fallope vers l'utérus continue. Après six jours, il y aura un ballon rempli de liquide creux de quelques centaines de cellules dans l'utérus et se fixe à la paroi de celui-ci. Nous parlons à ce stade de blastocyste, ou de germes. Les cellules semblent avoir des fonctions différentes. La forme extérieure du début du placenta et le cordon ombilical par lequel les nutriments et l'oxygène sont fournis et les déchets enlevés.

Un petit groupe de cellules - dénommé embryon - commence à l'intérieur de la graine se développer en une cavité. La cavité - placenta ou le placenta - est rempli de liquide amniotique, qui devrait inclure la protection de l'embryon d'un choc. Un embryon d'une semaine ancienne est 1,5 mm de large et se compose de trois couches: la première est le type de cellules que la peau, cheveux, ongles et le système nerveux se forme. La deuxième couche contient des cellules pour le squelette, les muscles et le système vasculaire, tandis que la troisième couche se développera en pulmonaire, digestif et d'autres organes. Les trois mêmes couches sont en tous les animaux ?? s embryon présente. Il dépend de l'ADN - les messages spécifiques du type de gènes - comment le développement se poursuit.

Dans environ deux mois, tous fabriqués fonctions importantes: cœur et les poumons, le squelette, les bras et les jambes, une grande tête avec les yeux et les oreilles dans la construction. Notre ADN contient deux anciens premiers gènes qui rendent les formes antérieures de la construction, que de nouveaux gènes puis il ont surgi au sujet de la forme humaine typique et l'ancien disparaissent. Après deux mois, le développement de la construction est terminée, on ne parle plus d'embryons, mais des fœtus. Ce est d'environ 2,5 cm et ne pèse que quelques grammes.

Le fœtus grandit et se développe encore. Un développement important est la fourniture de sexe. Ceci est réalisé par les hormones. Ce sont des composés chimiques qui sont à leur tour contrôlés par les gènes. L'hormone femelle appelée œstrogène. Ce est habituellement abondant dans le sang de la mère. Pour la formation d'un fœtus mâle une autre hormone est nécessaire, appelé androgène. Androgènes est créé par ordre de gènes sur le chromosome sexuel mâle XY. Les organes sexuels se développent à partir d'une forme commune. Après quatre mois, le fœtus commence à se étendre à partir de la position enroulée, la mère peut sentir le mouvement. Les organes viennent se placer à peu près à leur place, on forme une couche de graisse, et à la fin du sixième mois, le fœtus une moyenne en poids d'environ 1000 grammes. Les poumons ne sont pas encore prêts, mais comme un lieu de naissance prématurément désormais en compte les incubateurs modernes l'enfant peut vivre.

Les trois derniers mois, le fœtus est plus épaisse et plus grande et à la naissance du poids entre six et huit livres. Le bébé peut respirer, sucer, avaler, voir, entendre, pleurer, pour une meilleure adhérence et plus, mais est par ailleurs impuissant. Quand vous voyez comment rapidement la plupart des jeunes animaux peuvent marcher ou voler, vous devez conclure que les gens sont réellement les enfants nés prématurément. L'explication ne est pas difficile: la tête du bébé est grande. Et il nous donne aussi l'explication de l'évolution typique de l'homme. Les grandes forces principales à la naissance précoce. La naissance début requiert un enseignement plus. Une éducation plus signifie plus de possibilités d'apprendre et de transmettre des compétences complexes que la marche de parler, etc.

2. La production et l'interprétation des profils d'ADN

2.1 Information générale sur l'empreinte d'ADN
2.1.1 La mise en place de l'empreinte digitale d'ADN
L'Anglais Jeffreys introduit en 1985 comme la première méthode de matériel de trace pour créer une empreinte génétique. En 1987, le test était plus ou moins couramment utilisée, notamment aux Etats-Unis et la Grande-Bretagne. L'empreinte génétique est basée sur certaines caractéristiques générales de la génétique. Une telle caractéristique est que, dans chaque cellule du corps est exactement le même ADN. L'ADN dans un wangcel est exactement le même que l'ADN dans une cellule de sperme et ce est exactement le même que l'ADN dans une cellule de la peau de la même personne. Ce est aussi la raison qui peut servir comme matériau de trace essentiellement toutes les cellules de l'auteur

2.1.2 Le principe d'une empreinte digitale d'ADN
L'empreinte d'ADN axée sur des morceaux courts d'ADN, que l'on appelle des répétitions en tandem courtes en néerlandais ceux-ci sont également désignés en tant que marqueurs. Il se agit de nombreuses répétitions du même fragment. Le STR ?? s qui sont utilisés pour des enquêtes judiciaires, constitué de répétitions d'un fragment d'ADN de quatre bases de longueur, par exemple, comme indiqué 10. La pièce de guanine-adénine-thymine-cytosine est répétée dix fois ici. Parce que la longueur de la STR ?? s varie de personne à personne, les longueurs de STR formation d'une personne une sorte de l'empreinte digitale.
Aujourd'hui, nous comparons donc ?? n dix à quinze le STR de ??. La probabilité que deux personnes ont le même profil d'ADN est minime, de sorte ?? s un sur dix milliards de dollars.

2.2 L'ADN-empreinte classique
L'empreinte d'ADN classique est obtenu par les étapes suivantes:
  • Isolement de l'ADN
  • Amplification de l'ADN
  • La digestion de l'ADN
  • Séparation de l'ADN
  • Diviser les chaînes d'ADN
  • La détection des marqueurs
Ces étapes sont expliquées en détail ci-dessous.

2.2.1 Isolement de l'ADN
On commence par la détection du matériel génétique. Cela peut être considéré cheveux, sang, la salive, le sperme, ou flocons de la peau sur la scène du crime. Par la suite, l'ADN est isolé. Cela peut se effectuer de nombreuses manières, on peut utiliser, par exemple, des substances chimiques ou le noyau de la cellule mise sous pression qui sort de l'ADN.

2.2.2 ADN à amplifier
Souvent, on trouve une petite quantité de matériel génétique. Afin d'augmenter ce, il est fait usage d'une réaction en chaîne par polymérase. Cela peut en peu de temps pour multiplier une très petite quantité de matériau génétique à un grand nombre sans avoir besoin de cellules vivantes commencent à tomber. Il peut donc encore être établi une empreinte génétique. En outre, il est dans la plupart des cas suffisante pour que la matière de base d'une étude de contre-dessus. La technique PCR est particulièrement adapté pour un ADN qui est plus ou moins dégradé, pour créer une empreinte digitale d'ADN. ADN dégradé se trouve surtout dans la vieille et capable d'échantillons biologiques décomposés. Un autre avantage de cette technique est que on peut obtenir rapidement un résultat.

Dispositif PCR avec laquelle cette réaction est effectuée, est en fait rien de plus qu'un dispositif de chauffage et de refroidissement très précis des tubes contenant l'échantillon avec l'ADN et d'autres ingrédients qui sont nécessaires pour la réaction.
Ces ingrédients sont
  • les nucléotides libres,
  • un court molécules d'ADN simple brin, les soi-disant amorces
  • Une enzyme sous le nom de polymérase Thermus aquaticus

Taq polymérase est dérivée de bactéries qui vivent dans des sources chaudes et la possession d'enzymes qui sont actives à des températures très élevées.
Le processus commence par l'échauffement de l'échantillon à une température d'environ 90-95ºC, dans lequel chaque ADN à double brin est séparé en deux brins simples.

Cause: les liaisons hydrogène qui les brins "détiennent ensemble" sont beaucoup plus faibles que les liaisons entre les nucléotides dans une chaîne. Grâce à l'échauffement, rompt la liaison hydrogène, provoquant les cassures double brin jusqu'à tandis que les liaisons restent inchangées.

Ensuite, la température est réduite légèrement, ce qui est les amorces d'ADN lui permet de se lier aux chaînes séparées. Les amorces se lient parce qu'ils sont complémentaires à certaines séquences de chaque brin, qui sont situés à côté de la pièce de l'ADN qui doit être répliqué. Une fois que l'amorce est lié a la Taq polymérase se étendre l'ADN dans lequel les nucleotides individuels peuvent être utilisés. Le résultat final est une chaîne complémentaire à chaque chaîne unique d'origine. Dans ce premier cycle est doublé, l'ADN d'origine présente. Dans le cycle suivant, est de nouveau chauffé et refroidi de sorte que les nouvelles doubles brins sont séparés et chacun séparé copié par la Taq polymérase. Dans chaque cycle de mesure doit être doublé, le nombre de brins du fragment d'ADN désiré. Après environ 30 cycles, il ya beaucoup de copies d'ADN pour complément d'enquête présente.

ADN 2.2.3 Cut
Afin d'obtenir plusieurs morceaux d'ADN, l'ADN est coupé, cela se fait au moyen d'enzymes de restriction. Ces enzymes se assurer que les marqueurs ne sont pas affectés dans l'ADN.
Ils font ce qui suit;
Les enzymes de restriction reconnaissent un palindrome: Ils lisent l'ADN et d'identifier parmi les milliards de lettres certains mots courts.
Exemple: par exemple, ils reconnaissent GAATTC ou AAGCTT.
Ce ne sont pas des séquences aléatoires de lettres. L'autre face de la chaîne d'ADN est le même à savoir le mot mais dans la direction opposée:

AAGCTTofGAATTC
TTCGAA CTTAAG

Cela se appelle un palindrome.
-Après Ils ont reconnu une certaine palindrome ils ont coupé les deux chaînes d'ADN sont décalés par:
| Couper ici
Un AGCTT
TTCGAA
| Couper ici
Le résultat: deux morceaux d'ADN avec des extrémités cohésives.
chercher:

xxxxxxxxxAAGCTTxxxxxxxxxxxx
xxxxxxxxxTTCGA Axxxxxxxxxxxx
Les extrémités sont collants parce qu'ils aiment à se engager dans d'autres pièces en vrac de l'ADN avec l'empreinte complémentaire.


2.2.4 La séparation des fragments d'ADN selon leur taille au moyen d'électrophorèse sur gel
Les fragments d'ADN coupés ne sont pas tous égaux. Ils sont séparés par taille l'une de l'autre à l'aide d'une électrophorèse sur gel. Là, il est fait usage de la charge négative qui possède l'ADN. Un échantillon qui contient des fragments d'ADN de taille différente, est appliqué à un gel, qui est sous tension. Les fragments d'ADN sont attirés par le pôle positif et le déplacement dans le gel. Des fragments plus petits se déplacent plus vite que les plus grandes, de sorte que les divers fragments d'ADN sont séparés les uns des autres. Il y aura lieu à un motif de pelotes d'ADN dans le gel qui sont séparés par taille.
Ce est comme suit;

2.2.5 Fractionnement des chaînes de l'ADN
ADN constitué de deux brins identiques qui sont enroulés autour de l'autre. L'étape suivante consiste à séparer les deux brins identiques les uns des autres avec de la soude caustique. Le résultat est considéré comme l'ADN simple brin.

2.2.6 Emplacement des marqueurs
Les fragments d'ADN simple-brin sont ensuite transférés dans un nylonvel. Sur sorte ?? n feuille toucher les morceaux d'ADN pas aussi facilement endommagé. La séquence d'ADN du marqueur est exactement connue. Le nylonvel est maintenant lavé dans un bain avec des sondes. Les sondes sont des fragments d'ADN simple brin qui sont exactement de la même façon que le marqueur et sont en outre marqués radioactifs. Les sondes ont donc la même séquence que les marqueurs d'ADN. Les sondes sont marquées de manière à être en mesure de trouver des marqueurs. Il bloque, pour ainsi dire, un drapeau pour les sondes, de sorte que ceux-ci peuvent être reconnus. Est le marqueur présente dans l'ADN restera sur la sonde de se en tenir là. Se il n'y a pas de marqueur dans l'ADN de la matière de traces que la sonde ne colle pas. Nylonvel il est lavé avec les sondes collent pas être emportés. Le nylonvel collé avec des sondes placées sur un film photographique. Les sondes radioactives crée des taches noires sur le film. Ce sont les sites dans l'ADN, où une sonde est de se en tenir et donc l'endroit où se trouve le marqueur! Une sorte l'accord ?? ne parle pas beaucoup, ce est la combinaison de plusieurs marqueurs. Ce est un type de code-barres qui est tout à fait unique.

La recherche d'ADN classique montre quatre profils d'ADN différentes obtenues à partir de l'enquête de profilage d'ADN après une infraction sexuelle. Dans les pistes 1 et 6 sont appliqués aux fragments des fragments d'une séquence d'ADN standard. Les longueurs des fragments de cette gamme standard sont exactement connus. En raison des positions des bandes dans les profils d'ADN à mesurer précisément, peut être déterminée, les longueurs de fragments des échantillons étudiés par interpolation ainsi. La piste 2 montre le profil d'ADN du sang du suspect. La piste 3 montre le profil d'un échantillon d'ADN de contrôle. Cet ADN de commande sera prise sur chaque gel, et elle est importante pour le contrôle de qualité. Lane 4 montre le profil d'ADN de sperme trouvé dans le frottis vaginal de la victime. Lane 5 montre le profil d'ADN de sperme trouvé dans la culotte de la victime. Dans la piste 7, l'ADN de la victime a été appliqué. On a constaté que les profils d'ADN des traces de sperme contestées coïncident avec les profils de la suspect. Dans ce cas, la probabilité qu'un ADN aléatoire Profils Dutchman même propriété que celle du sperme examinés colore moins d'un sur dix millions.

2.3 Le SGM, plus empreinte ADN
2.3.1 technique Multiplex
De 1996 à la fin de 1999, les laboratoires européens ont utilisé une technique PCR multiplex, qui sont multiplié et analysé à la fois six marqueurs sur différents chromosomes et un marqueur d'ADN spécifique du sexe. . La probabilité qu'un hasard, personne innocente avec cette méthode a le même profil d'ADN que la piste de gauche est inférieure à un sur un million. Fin de 1999. En Europe, le système SGM plus PCR multiplex a été introduit. Dans ce système multiplex, quatre nouveaux marqueurs d'ADN ajoutés au système. Cette identification est devenu quasiment certain. Le profil le plus courant SGM Plus a une fréquence de moins d'un sur deux milliards.

The'SGM plus 'empreinte ADN est obtenu par les étapes suivantes:
  • Isolement de l'ADN
  • Amplification de l'ADN
  • Séparation de l'ADN
  • La détection de l'ADN
  • Lire un électrophérogramme

Ces étapes sont expliquées en détail ci-dessous.

2.3.2 Isolement de l'ADN
On commence par la détection du matériel génétique dont ils ont besoin. Cela peut être considéré cheveux, sang, la salive, le sperme, ou flocons de la peau sur la scène du crime. Par la suite, l'ADN est isolé. Ceci peut être réalisé de différentes manières, on peut utiliser, par exemple, des substances chimiques ou le noyau de la cellule mise sous pression qui sort de l'ADN.

2.3.3 amplifier l'ADN par PCR multiplex
expositions d'ADN fluorescence guère naturel, il est donc nécessaire d'étiqueter le fluorescente d'ADN. Cela se fait avec le procédé de PCR multiplex. Il se agit d'un procédé de PCR dans laquelle plusieurs éléments d'ADN à copier simultanément. Chaque copie est lancée avec des amorces qui sont ajoutés à la réaction et qui sont couplés chacun à un marqueur fluorescent. De cette façon, après la réaction de PCR multiplex, chacun du fragment d'ADN amplifié et pertinent marqué à la fluorescéine. Pour les amorces des 11 étiquettes différentes sont trois marqueurs fluorescents sont disponibles. Les couleurs utilisées ici sont en bleu, vert et jaune.

ADN 2.3.4 Cut
Parce que ce est une méthode pas à jour, ce au plus SGM profil ne est plus utilisé.

2.3.5 Séparation par la taille avec électrophorèse capillaire
Puis les morceaux sont séparés par électrophorèse capillaire.
Dans l'électrophorèse capillaire, l'échantillon est pneumatique ou électro-cinétique logé dans un capillaire, est ci-après désigné sous une tension de 30 kV sur le tube capillaire est mis par lequel les divers composants sont séparés. Si l'échantillon besoin d'au moins environ 15 microlitres, une petite partie de cette est introduit dans le capillaire.

Se il ya détection UV utilisé est appelé un CE-LIF

2.3.6 Electropherogrammen
Les données acquises sont analysées par l'ordinateur et le résultat est le profil d'ADN. Ceux-ci peuvent être affichés dans une sorte de graphique, qui est considéré comme un électrophérogramme.

2.3.7 Gel vue
Les données acquises peuvent également être affichées d'une manière différente, à savoir avec le gelview du système SGM Plus. Ce gelview ?? ?? De plus le système de SGM est obtenue par le séquenceur automatique. Trois marqueurs fluorescents différents sont disponibles pour les amorces des marqueurs 11verschillende. La quatrième couleur est réservée à la norme de la voie interne. Cette norme avec des fragments d'ADN de longueur connue courir avec chaque échantillon à tester sur le gel avec elle. Par interpolation sont longueurs des fragments de PCR est calculé. De la durée résultante suit le nombre de marqueurs dans le fragment. Les amorces des loci qui ont une longueur des fragments de chevauchement, portent une étiquette de couleur différente, de sorte que les fragments PCR clairement être identifiés pour le locus particulier.

Ce tableau montre les 11 marqueurs différents.
VOIR AUSSI:
  1.  
  2.  
  3.  
Sans commentaires

Laisser un commentaire

Code De Sécurité